Detailed locus information, expression profile, gene disruption strategy, and phenotype assay data.
| Species | Cryptococcus neoformans var. grubii H99 |
|---|---|
| Gene Annotation | hypothetical protein |
| Gene Symbol | GLN3 |
| TF Family Name | Not defined Classification based on Fungal Transcription Factor DB |
| KEGG Linkout | N/A |
| Genome Browser | JBrowse link goes here. Sequence information also available from JBrowse. |
| Functional Annotation | No functional annotation available. |
| Amino Acid Sequence | MIPEDHQPLPSLPSSPSPEFKPLIPLSPEPHSLSPPLRTVTPSQSQQPIKTIATHKKNASINQGSRFPSCTPQNDRQCTNCGETDTPQWRGTLCNACALWKRSRGTDRPLPLLFPVRKRSLSCGDDEEGERERSPDEILESWKLRNHVTGYRRTLSIQPHPVTINGRPTPGYALPRPTAFYPSMADGQTTQLLSSTEQGLPSKIASMTQAHSYARGRQLGRNIEGGKREAEETEVRFPKFTRSPYSFQGEPRTISLERQYSAVRYNRYALSRQEFMRGAEWLYDVLQQTSKLLGDMDNDEERAP |
| Notation | Condition | Normalized Raw Expression |
|---|---|---|
| A | YPD 30°C, concentration: 2x 10^8 cells/ml | 174 |
| B | YPD 30°C, concentration: 5x10^7 cells/ml | 73 |
| C | YPD 30°C, fluconazole treatment, concentration: 5x10^7 cells/ml | 57 |
| D | YPD 30°C, SDS 0.01% treatment, concentration: 5x10^7 cells/ml | 44 |
| E | YPD 37°C, concentration: 5x10^7 cells/ml | 297 |
| F | YP+galactose 30°C, concentration: 2x10^8 cells/ml | 435 |
| Primer Name | Description | Primer Sequence |
|---|---|---|
| L1 | 5' flanking region primer 1 | CCATTATCATCCGTCACCAC |
| L2 | 5' flanking region primer 2 | CTGGCCGTCGTTTTACGAAGAGGGAAGAGAGGGTAAC |
| PO | Southern blot probe primer | TGGTAAAGGTCTATCAGTGCC |
| R1 | 3' flanking region primer 1 | GTCATAGCTGTTTCCTGTGAGGCTGAGGAAACAGAG |
| R2 | 3' flanking region primer 2 | TCCTTTTCCCAACCTGTC |
| SO | diagnostic screening primer, pairing with B79 | TTCAGTGGTTGGTCTCTACAG |
| Growth | |
|---|---|
|
|
| Mating Data | |
|
|
| Virulence Factor Production | |
|
Capsule
Urease
Melanin
|
|
| Stress Response and Adaptation | |
|
Osmotic Stress
Oxidative Stress
Heavy Metal Stress
Cell Wall Stress
ER Stress
Genotoxic Stress
|
|
| Antifungal Drug Susceptibility | |
|
|
| Virulence Data by the Insect Host Model (Galleria mellonella) | |
|
|
| Lung Infectivity Data by the Signature-tag Mutagenesis-based Murine Host Model | |
|